Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06975

HP ID(1) HP06975
Gene ID(2) 9600
Gene Symbol finder PITPNM1
Protein Name phosphatidylinositol transfer protein, membrane-associated 1
RefSeq NM_004910.2
Length of RefSeq (bp) 4248
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.372295

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd10A09 pGCAP10 GGACGCGGCGGGCGTCGGGGAGGGACTGCAGGGGCGCCGGCGGGCGGATCGAGAGGAAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl