Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06960

HP ID(1) HP06960
Gene ID(2) 56270
Gene Symbol finder WDR45L
Protein Name WDR45-like
RefSeq NM_019613.3
Length of RefSeq (bp) 2596
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.132161

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd09B12 pGCAP10 GTCGCCCCGCCCCGCCCCTCCCCGCCCTGCCTCGCCTCGTCTCGCCTCGCTTCGGTTAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl