Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06946

HP ID(1) HP06946
Gene ID(2) 60491
Gene Symbol finder NIF3L1
Protein Name NIF3 NGG1 interacting factor 3-like 1 (S. pombe)
RefSeq NM_021824.2
Length of RefSeq (bp) 1606
Chromosome 2q33
Reference DDBJ accession
UniGene Hs.145284

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd08B04 pGCAP10 AAAAAACCCGCGAGTGTAGTTGTGACCTTCGCGGTAGGTGCCGGTTGGGGCCGGCTGTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl