Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06944

HP ID(1) HP06944
Gene ID(2) 9874
Gene Symbol finder TLK1
Protein Name tousled-like kinase 1
RefSeq NM_012290.4
Length of RefSeq (bp) 5751
Chromosome 2q31.1
Reference DDBJ accession
UniGene Hs.596942

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd08A07 pGCAP10 GGGCGCGTGACGCCGCCGCCGCCTGTAACTGATGCAGAGGTTACCCCACCGCCTCAGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl