Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06934

HP ID(1) HP06934
Gene ID(2) 5447
Gene Symbol finder POR
Protein Name P450 (cytochrome) oxidoreductase
RefSeq NM_000941.2
Length of RefSeq (bp) 2509
Chromosome 7q11.2
Reference DDBJ accession
UniGene Hs.354056

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd07D04 pGCAP10 GAGAGAGCAGCCGGGCTGCCAGCGTTTCATGATCAACATGGGAGACTCCCACGTGGACAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl