Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06912

HP ID(1) HP06912
Gene ID(2) 29914
Gene Symbol finder UBIAD1
Protein Name UbiA prenyltransferase domain containing 1
RefSeq NM_013319.2
Length of RefSeq (bp) 3687
Chromosome 1p36.22
Reference DDBJ accession
UniGene Hs.522933

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi10F10 pGCAP10 CGGCCGGCCGATGAGAGGCCGGCGCACAAGATGGCGGCTCTGGCGGCCTAAAGAAGGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl