Prev. | NRCD Clone E | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06902

HP ID(1) HP06902
Gene ID(2) 254102
Gene Symbol finder EHBP1L1
Protein Name EH domain binding protein 1-like 1
RefSeq NM_001099409.1
Length of RefSeq (bp) 5197
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.502867

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi09A01 pGCAP10 GGACGGGGGTGCGGCTCCAGGAAACGGCGCGCTCCCAGCTCCGCGCTCGCCACCCGACGC
ARi46C05 pGCAP10 GGCCCGCCTTCCGACGGGGGTGCGGCTCCAGGAAACGGCGCGCTCCCAGCTCCGCGCTCG
ARi47D02 pGCAP10 GGCCCGCCTTCCGACGGGGGTGCGGCTCCAGGAAACGGCGCGCTCCCAGCTCCGCGCTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl