Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06894

HP ID(1) HP06894
Gene ID(2) 7726
Gene Symbol finder TRIM26
Protein Name tripartite motif-containing 26
RefSeq NM_003449.3
Length of RefSeq (bp) 3499
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.485041

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi07G03 pGCAP10 GAGACCGCCGTGAGAGAGGAGGGGTGCCGGCCGGGATTCGCGGCCCGGAGCTCGGGACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl