Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06885

HP ID(1) HP06885
Gene ID(2) 3799
Gene Symbol finder KIF5B
Protein Name kinesin family member 5B
RefSeq NM_004521.2
Length of RefSeq (bp) 5905
Chromosome 10pter-q22.1
Reference DDBJ accession
UniGene Hs.644646

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi07C04 pGCAP10 GGTCGCCCAACGGCGGCCTCAGGAGTGATCGGGCAGCAGTCGGCCGGCCAGCGGACGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl