Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06864

HP ID(1) HP06864
Gene ID(2) 7257
Gene Symbol finder TSNAX
Protein Name translin-associated factor X
RefSeq NM_005999.2
Length of RefSeq (bp) 2667
Chromosome 1q42.1
Reference DDBJ accession
UniGene Hs.96247

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd06B03 pGCAP10 GGTAGTCGGCCCGGCTGCAAAGCGTTTTTCTGCAGGCTGTTTTCCCAGGTTCCCTCGGCC
RBd12B10 pGCAP10 GGAGAGGAGACTTCCGGCCACTGCGTTGTAGTCGGCCCGGCTGCAAAGCGTTTTTCTGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl