Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06863

HP ID(1) HP06863
Gene ID(2) 7188
Gene Symbol finder TRAF5
Protein Name TNF receptor-associated factor 5
RefSeq NM_004619.3
Length of RefSeq (bp) 3988
Chromosome 1q32
Reference DDBJ accession
UniGene Hs.523930

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd06B01 pGCAP10 GAGGCCTCGCCTCCGCTTCGCCGCCGCCGCCGGCCGCAGCCAGGAGCAGCAGCCGCGCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl