Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06818

HP ID(1) HP06818
Gene ID(2) 10482
Gene Symbol finder NXF1
Protein Name nuclear RNA export factor 1
RefSeq NM_006362.4
Length of RefSeq (bp) 2346
Chromosome 11q12-q13
Reference DDBJ accession
UniGene Hs.523739

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd02A02 pGCAP10 ACTTCGGTCCTGAGCGCTTGGGAGTTAGGTTGTTTGCCGGCGTAGCGGCCAGCGCCTGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl