Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06811

HP ID(1) HP06811
Gene ID(2) 28512
Gene Symbol finder NKIRAS1
Protein Name NFKB inhibitor interacting Ras-like 1
RefSeq NM_020345.3
Length of RefSeq (bp) 2013
Chromosome 3p24.2
Reference DDBJ accession
UniGene Hs.173202

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd01F06 pGCAP10 GGCGGCTAAGCGAGCGTCGGCGACTGTCTCTCCGCGAGAGGAGGCAAGTTGGGGTCCAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl