Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06810

HP ID(1) HP06810
Gene ID(2) 6924
Gene Symbol finder TCEB3
Protein Name transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)
RefSeq NM_003198.1
Length of RefSeq (bp) 2676
Chromosome 1p36.1
Reference DDBJ accession
UniGene Hs.584806

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd01D08 pGCAP10 GGAGGCCGCGCCAGTGACAGCGATGGCGGCGGAGTCGGCGCTCCAAGTTGTGGAGAAGCT
RBd06E02 pGCAP10 GGGGGATGCNCGGAGGGCGGAGCTGCGGCCCGAGGACGCGACGCGAGCCCAGTTCCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl