Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06780

HP ID(1) HP06780
Gene ID(2) 25893
Gene Symbol finder TRIM58
Protein Name tripartite motif-containing 58
RefSeq NM_015431.3
Length of RefSeq (bp) 5158
Chromosome 1q44
Reference DDBJ accession
UniGene Hs.323858

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf05E07 pKA1U5 GGTCATGGCCTCGGCGCCGCCCGGGGAGCGGCTGCGCGAGGATGCGCGGTGCCCGGTGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl