Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06769

HP ID(1) HP06769
Gene ID(2) 81556
Gene Symbol finder C15orf44
Protein Name chromosome 15 open reading frame 44
RefSeq NM_030800.1
Length of RefSeq (bp) 2538
Chromosome 15q22.31
Reference DDBJ accession
UniGene Hs.6686

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf03H12 pKA1U5 GGTGTCCGGCGATGGGCACGGGGTGAGTGGGGAGGCCGAGGGCCCGGGACTGCCTTTCGC
ARiS109I13 pGCAP10 GACTGTGTCCGGCGATGGGCACGGGCATTTCTTCGTTTATAGCTGTCTGTTTGCATTCTG
RBdS154B04 pGCAP10 GATAGTTCCGGCTGTGGCGCGCGGACGGAAAGTTTATGCCGACGGAAAGTTTATGCCGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl