Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06766

HP ID(1) HP06766
Gene ID(2) 29922
Gene Symbol finder NME7
Protein Name non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)
RefSeq NM_013330.3
Length of RefSeq (bp) 1646
Chromosome 1q24
Reference DDBJ accession
UniGene Hs.706952

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf03E02 pKA1U5 GGTCTTCCTGTCTCAACGATACCTATTTTCTAGTGCTGAGATCCTGAGACAATGAATCAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl