Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06761

HP ID(1) HP06761
Gene ID(2) 55281
Gene Symbol finder TMEM140
Protein Name transmembrane protein 140
RefSeq NM_018295.2
Length of RefSeq (bp) 1680
Chromosome 7q33
Reference DDBJ accession
UniGene Hs.658637

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf02C04 pKA1U5 GAGGCACGACTGCGAAGGCAAGGGGGCACCAGCTCAGGACTGCATCTGCCTGCCATTTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl