Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06758

HP ID(1) HP06758
Gene ID(2) 11107
Gene Symbol finder PRDM5
Protein Name PR domain containing 5
RefSeq NM_018699.2
Length of RefSeq (bp) 2492
Chromosome 4q25-q26
Reference DDBJ accession
UniGene Hs.666782

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf01E01 pKA1U5 GCTTCCCTGCCGGTTTCTCCCCTCTACCCTGGCACCCCAAATTTCGATGTGCCGCCTGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl