Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06756

HP ID(1) HP06756
Gene ID(2) 25962
Gene Symbol finder KIAA1429
Protein Name KIAA1429
RefSeq NM_015496.3
Length of RefSeq (bp) 5786
Chromosome 8q22.1
Reference DDBJ accession
UniGene Hs.202238

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf01D01 pKA1U5 GGCCCGCGGCAAACATGGCGGTGGACTCGGCGATGGAGCTGTTATTTTTAGATACTTTTA
RBdS015K02 pGCAP10 GGTTCCCCGCCCGCGGCAAACATGGCGGTGGACTCGGCGATGGAGCTGTTATTTTTAGAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl