Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06750

HP ID(1) HP06750
Gene ID(2) 54058
Gene Symbol finder C21orf58
Protein Name chromosome 21 open reading frame 58
RefSeq NM_058180.3
Length of RefSeq (bp) 2991
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.236572

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe99D01 pKA1U5 GAGCGGGCCGGGCTCCCTGCAGGCGCGGGCGGCGCCGAACGGTGCTCAGCAACCACCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl