Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06749

HP ID(1) HP06749
Gene ID(2) 78994
Gene Symbol finder PRR14
Protein Name proline rich 14
RefSeq NM_024031.2
Length of RefSeq (bp) 2154
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.293629

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe99C03 pKA1U5 GGGAAGACCCGGGATCCACGGGAGGCGGCGGCCGCAGCCTGGGATTCCCCAGGGACCCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl