Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06733

HP ID(1) HP06733
Gene ID(2) 4681
Gene Symbol finder NBL1
Protein Name neuroblastoma, suppression of tumorigenicity 1
RefSeq NM_005380.4
Length of RefSeq (bp) 2021
Chromosome 1p36.13-p36.11
Reference DDBJ accession
UniGene Hs.654502

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe96D07 pKA1U5 GGCGCAGCGCAGCCCAGCCGAGCGTCGCGGGGCCGCCCCCCGCCCTGCCGGCCGCCTCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl