Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06681

HP ID(1) HP06681
Gene ID(2) 80119
Gene Symbol finder PIF1
Protein Name PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)
RefSeq NM_025049.2
Length of RefSeq (bp) 2659
Chromosome 15q22.31
Reference DDBJ accession
UniGene Hs.112160

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb45E05 pGCAP1 GGTTCATCTGAGTGTCGGCACAAACCAGCAGAGGCGGTGACGATGCTCTCGGGCATAGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl