Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06680

HP ID(1) HP06680
Gene ID(2) 65980
Gene Symbol finder BRD9
Protein Name bromodomain containing 9
RefSeq NM_023924.3
Length of RefSeq (bp) 2843
Chromosome 5p15.33
Reference DDBJ accession
UniGene Hs.449278

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096J12 pGCAP10 GGCCCCGTTTCCGGCGCGGCCCAGCGAGCTCGGCAACCTCGGCGCAGCGAGCGCGGGCGG
RBb45C04 pGCAP1 GCCCGTTTCCGGCGCGGCCCAGCGAGCTCGGCAACCTCGGCGCAGCGAGCGCGGGCGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl