Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06670

HP ID(1) HP06670
Gene ID(2) 137695
Gene Symbol finder TMEM68
Protein Name transmembrane protein 68
RefSeq NM_152417.1
Length of RefSeq (bp) 2317
Chromosome 8q12.1
Reference DDBJ accession
UniGene Hs.420076

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb72B04 pGCAP1 GGCCGTGCAAATCTGTCCGCCCCCTTGGCCACTGATCCCCCGAAGAGCTTCTGTCGCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl