Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06656

HP ID(1) HP06656
Gene ID(2) 79953
Gene Symbol finder C20orf39
Protein Name chromosome 20 open reading frame 39
RefSeq NM_024893.1
Length of RefSeq (bp) 2437
Chromosome 20p11.21
Reference DDBJ accession
UniGene Hs.124638

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb70D04 pGCAP1 GGCGCGCAGACCCGGCGGCGGCGTGGCGCCCGCGGAGAAATGGCTTCCCTGAGGCAAGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl