Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06631

HP ID(1) HP06631
Gene ID(2) 84224
Gene Symbol finder NBPF3
Protein Name neuroblastoma breakpoint family, member 3
RefSeq NM_032264.2
Length of RefSeq (bp) 3783
Chromosome 1p36.12
Reference DDBJ accession
UniGene Hs.325422

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS008H21 pGCAP10 GGAGACAGCGGCGGTACTGGGAGGCGTAGGTGAGGGTCGCGAGGCTGCCCGAGCTTCTGA
RBb67E07 pGCAP1 GGCAGGCGCAGGCGCAGGCGAGGGGCTGGGTGGCGGTTGAGACAGCGGCGGTACTGGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl