Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06625

HP ID(1) HP06625
Gene ID(2) 91107
Gene Symbol finder TRIM47
Protein Name tripartite motif-containing 47
RefSeq NM_033452.2
Length of RefSeq (bp) 2268
Chromosome 17q24-q25
Reference DDBJ accession
UniGene Hs.293660

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe91G02 pKA1U5 GGACTCAGTCAGCTTCCTGCAGGTGAAGGCCGCTCTGGGGGCCACGGAAGGAACAGAAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl