Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06615

HP ID(1) HP06615
Gene ID(2) 10330
Gene Symbol finder TMEM4
Protein Name transmembrane protein 4
RefSeq NM_014255.4
Length of RefSeq (bp) 1209
Chromosome 12q15
Reference DDBJ accession
UniGene Hs.8752

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe12G08 pKA1U5 GGGGACACCCCGNTGNTGTGGCAGGCGGCGAAGCNCCTNTGGAGAATCCCGGACAGCCCT
ARe90E10 pKA1U5 GGGGACACCCCGNTGNTGTGGCAGGCGGCGAAGCGCTCTGGAGAATCCCGGACAGCCCTG
ARi53E07 pGCAP10 GGAGAGTCCAGCGGTCTTCCAGCGCTTGGGCCACGGCGGCGGCCCTGGGAGCAGAGGTGG
ARiS150J10 pGCAP10 GAGAGTCCAGCGGTCTTCCAGCGCTTGGGCCACGGCGGCGGCCCTGGGAGCAGAGGTGGA
RBb15C08 pKA1U5 GAGGCGGTCGCCGGGACACCCCGNTGTGTGGCAGGCGGCGAAGCGCTCTGGAGAATCCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl