Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06591

HP ID(1) HP06591
Gene ID(2) 7342
Gene Symbol finder UBP1
Protein Name upstream binding protein 1 (LBP-1a)
RefSeq NM_014517.4
Length of RefSeq (bp) 4162
Chromosome 3p22.3
Reference DDBJ accession
UniGene Hs.714881

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe88D09 pKA1U5 GGGGAGGCCACCCCGGCTGGGAACAGCCGCGCTGGNCGGGGCCGCATTGCACTCTCTGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl