Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06590

HP ID(1) HP06590
Gene ID(2) 285343
Gene Symbol finder C3orf23
Protein Name chromosome 3 open reading frame 23
RefSeq NM_173826.3
Length of RefSeq (bp) 3702
Chromosome 3p21.33-p21.32
Reference DDBJ accession
UniGene Hs.55131

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe88D03 pKA1U5 GAGTCCCTTTCCCCTTCTTCCCCAAGATCCAGCGCGTGCTCGGTTGCCCTTCTCCGTTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl