Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06566

HP ID(1) HP06566
Gene ID(2) 770
Gene Symbol finder CA11
Protein Name carbonic anhydrase XI
RefSeq NM_001217.3
Length of RefSeq (bp) 1686
Chromosome 19q13.3
Reference DDBJ accession
UniGene Hs.428446

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe23G11 pKA1U5 GAGTGCTTCTCGACCTGGTACATTCTGGTTCCCCGCTCGCAGACTTCCGACGTGGATGGT
RBb65G11 pGCAP1 GAGCGCGGCTGGGAGCCGAGGACCAGCCCCCTACCTCCTTCCGAATCCTGCCCTTTCGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl