Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06554

HP ID(1) HP06554
Gene ID(2) 51315
Gene Symbol finder KRCC1
Protein Name lysine-rich coiled-coil 1
RefSeq NM_016618.1
Length of RefSeq (bp) 1774
Chromosome 2p11.2
Reference DDBJ accession
UniGene Hs.469254

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS049L06 pGCAP10 GGCGGTTGTTCCTGCCTCTCCGCCACCTCCACCGCGGCTTATCCCCTGGCTGGCGGCGTT
RBb64B07 pGCAP1 GCTGCTCGGCGGCGGAGGCGGCGGTGACGGCAGCTGTTGTTCCTGCCTCACGCCCCTACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl