Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06549

HP ID(1) HP06549
Gene ID(2) 25959
Gene Symbol finder KANK2
Protein Name KN motif and ankyrin repeat domains 2
RefSeq NM_015493.6
Length of RefSeq (bp) 4966
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.719195

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe85B05 pKA1U5 GGGGCGGCGGGACCCAGGGAAGGCAGCGGCCGGAGCGCGCAAGGTGTTGAAAGACAGAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl