Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06539

HP ID(1) HP06539
Gene ID(2) 7025
Gene Symbol finder NR2F1
Protein Name nuclear receptor subfamily 2, group F, member 1
RefSeq NM_005654.4
Length of RefSeq (bp) 3210
Chromosome 5q14
Reference DDBJ accession
UniGene Hs.519445

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe80C03 pKA1U5 GGCTCAGGCAGTGGCTGGACACACTGAGCTGTGGAGCTGGAGGGCCTCACCCCAGATCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl