Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06520

HP ID(1) HP06520
Gene ID(2) 5074
Gene Symbol finder PAWR
Protein Name PRKC, apoptosis, WT1, regulator
RefSeq NM_002583.2
Length of RefSeq (bp) 1967
Chromosome 12q21
Reference DDBJ accession
UniGene Hs.643130

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe82A07 pKA1U5 GGGGGACCCGGCGGCTGCTGGCCGGTAGTGACTGGTGGGCGCGCTCGAGGACTCCAAGGG
ARiS194H11 pGCAP10 GGCANGNTGNGGACCCGGCGGCTGCTGGCCGGTAGTGACTGGTGGGCGCGCTCGAGGACT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl