Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06480

HP ID(1) HP06480
Gene ID(2) 79876
Gene Symbol finder UBA5
Protein Name ubiquitin-like modifier activating enzyme 5
RefSeq NM_024818.3
Length of RefSeq (bp) 3044
Chromosome 3q22.1
Reference DDBJ accession
UniGene Hs.170737

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe76B08 pKA1U5 ATCCTGGGAGGAAGGCCTGTGGGAGTCTCGGACACTTGTCTGTCTGTGAGGCGCTGGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl