Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06399

HP ID(1) HP06399
Gene ID(2) 5025
Gene Symbol finder P2RX4
Protein Name purinergic receptor P2X, ligand-gated ion channel, 4
RefSeq NM_002560.2
Length of RefSeq (bp) 2043
Chromosome 12q24.32
Reference DDBJ accession
UniGene Hs.321709

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb60G11 pGCAP1 ACTGGGACCCAGACCGACTAGGGGACTGGGAGCGGGCGGCGCGGCCATGGCGGGCTGCTG
RBdS110M15 pGCAP10 GGGGAGCGGGCGGCGCGGCCATGGCGGGCTGCTGCGCCGCGCTGGCGGCCTTCCTGTTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl