Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06384

HP ID(1) HP06384
Gene ID(2) 91653
Gene Symbol finder BOC
Protein Name Boc homolog (mouse)
RefSeq NM_033254.2
Length of RefSeq (bp) 4293
Chromosome 3q13.2
Reference DDBJ accession
UniGene Hs.591318

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh12G02 pGCAP1 GATCATTTTCTCCACCGCCGCTGTCCCATTTTCTGATGAGTTTGCTTTTAATGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl