Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06383

HP ID(1) HP06383
Gene ID(2) 27077
Gene Symbol finder B9D1
Protein Name B9 protein domain 1
RefSeq NM_015681.3
Length of RefSeq (bp) 932
Chromosome 17p11.2
Reference DDBJ accession
UniGene Hs.462445

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi25B09 pGCAP10 GGCACTCGCGTGGCCTTCGCGAAGGTGTCGCTGCCAAGAAACGTGTCCTGCGCGCTACGC
RBd41F08 pGCAP10 GGGCCTTCGCGAAGGTGTCGCTGCCAAGAAACGTGTCCTGCGCGCTACGCCGTCTGTTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl