Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06377

HP ID(1) HP06377
Gene ID(2) 51465
Gene Symbol finder UBE2J1
Protein Name ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)
RefSeq NM_016021.2
Length of RefSeq (bp) 4360
Chromosome 6q15
Reference DDBJ accession
UniGene Hs.163776

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe83D11 pKA1U5 GGCAGTCCAGGCTGGACTGGGCGGCATTTGCCGAGGCTCCTCGGCCAGGCCCCGTCCGCC
ARf04D03 pKA1U5 GACTCAGGGAGGCGGGGGCGCAGTGGAGGAGGCGGCGCCATCGCGAAGCGAGCGCCTCGC
ARiS013G20 pGCAP10 GACCCCGCCCGCAGTCCAGGCTGGACTGGGCGGCATTTGCCGAGGCTCCTCGGCCAGGCC
ARiS055M18 pGCAP10 GACCCCGCCCGCAGTCCAGGCTGGACTGGGCGGCATTTGCCGAGGCTCCTCGGCCAGGCC
RBd26D09 pGCAP10 GAGGGCTGGGCCTGCGACTACCCGAGGAGGCTGACCTCCAGCCCGGGCGCCCGGTTCAGC
RBd77F06 pGCAP10 GAGGGCTGGGCCTGCGACTACCCGAGGAGGCTGACCTCCAGCCCGGGCGCCCGGTTCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl