Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06375

HP ID(1) HP06375
Gene ID(2) 4664
Gene Symbol finder NAB1
Protein Name NGFI-A binding protein 1 (EGR1 binding protein 1)
RefSeq NM_005966.3
Length of RefSeq (bp) 4499
Chromosome 2q32.3-q33
Reference DDBJ accession
UniGene Hs.570078

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh11B11 pGCAP1 TGGCTGCCGCCGCCGCCGCCGCCCGCGCGCCGCAGCCTGGAGGAGCCGCCGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl