Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06366

HP ID(1) HP06366
Gene ID(2) 79770
Gene Symbol finder TXNDC15
Protein Name thioredoxin domain containing 15
RefSeq NM_024715.3
Length of RefSeq (bp) 3689
Chromosome 5q31.1
Reference DDBJ accession
UniGene Hs.696335

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS198B14 pGCAP10 GGCCGTGCGCCGATTGCCTCTCGGCCTGGGCAATGGTCCCGGCTGCCGGTCGACGACCGC
ARiS198B20 pGCAP10 GGCCGNGCGCCGATNGCCTCTCGGCCTGGGCAATGGTCCCGGCTGCCGGTCNACNACCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl