Prev. | NRCD Clone E | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06351

HP ID(1) HP06351
Gene ID(2) 9669
Gene Symbol finder EIF5B
Protein Name eukaryotic translation initiation factor 5B
RefSeq NM_015904.3
Length of RefSeq (bp) 4698
Chromosome 2q11.2
Reference DDBJ accession
UniGene Hs.158688

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi17A07 pGCAP10 GATGTGTCCTGTTCCAGTGCGCGGGTCTGTGGAGAGCCGGGTGCGAGCGGCGGCAGCACG
RBd28D07 pGCAP10 GATATGTGTCCTGTTCCAGTGCGCGGGTCTGTGGAGAGCCGGGTGCGAGCGGCGGCAGCA
RBd53H08 pGCAP10 GGGAGAGCCGGGTGCGAGCGGCGGCAGCACGAGGGGAAAAGNNNNGNGCGGAGACCAAAG
RBd56D12 pGCAP10 GGTGGAGAGCCGGGTGCGAGCGGCGGCAGCACGAGGGGAAAAGAGCTGAGCGGAGACCAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl