Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06342

HP ID(1) HP06342
Gene ID(2) 56654
Gene Symbol finder NPDC1
Protein Name neural proliferation, differentiation and control, 1
RefSeq NM_015392.3
Length of RefSeq (bp) 1548
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.457

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi46G03 pGCAP10 GGGATCCTTGCTGCAGCGTCAGCGCCGCCGCCCGTGCCTTTCCTCTTCCTCCTCCTCCTC
ARiS096A07 pGCAP10 GGCTTGCTGCAGCGTCAGCGCCGCCGCCCGTGCCTTTCCTCTTCCTCCTCCTCCTCCTTG
RBdS105F07 pGCAP10 GGGATCCTTGCTGCAGCGTCAGCGCCGCCGCCCGTGCCTTTCCTCTTCCTCCTCCTCCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl