Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06325

HP ID(1) HP06325
Gene ID(2) 221143
Gene Symbol finder N6AMT2
Protein Name N-6 adenine-specific DNA methyltransferase 2 (putative)
RefSeq NM_174928.1
Length of RefSeq (bp) 890
Chromosome 13q12.11
Reference DDBJ accession
UniGene Hs.26674

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh06F11 pGCAP1 GAGTCTGGGCGACTGCGCACGCGCGGCTGGTTATAAACAACTTGTGAAATGA
RBdS040A11 pGCAP10 GGCACACGGCGAGTCTGGGCGACTGCGCACGCGCGGCTGGTTATAAACAACTTGTGAAAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl