Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06324

HP ID(1) HP06324
Gene ID(2) 80019
Gene Symbol finder UBTD1
Protein Name ubiquitin domain containing 1
RefSeq NM_024954.3
Length of RefSeq (bp) 1575
Chromosome 10q24.1
Reference DDBJ accession
UniGene Hs.500724

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh06F04 pGCAP1 GCCCCTCCAGCGGAGCTGGTCTCCGGCCGGGCACCGTCGCGGGCCCCCCTGGCCCGGCCA
RBd18G09 pGCAP10 GGCTCCCCCCTTTTCTCCCCCCCTCCAGCGGAGCTGGTCTCCGGCCGGGCACCGNAGNCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl