Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06316

HP ID(1) HP06316
Gene ID(2) 80194
Gene Symbol finder TMEM134
Protein Name transmembrane protein 134
RefSeq NM_025124.2
Length of RefSeq (bp) 930
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.288761

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085O24 pGCAP10 GGGGTGTGTGGGCGCAGATGGCGGCGGCGCACGGCGCCTGAGCGGGCCGGGGCCATGAGC
RBdS132I24 pGCAP10 GACGGCGCCTGAGCGGGCCGGGGCCATGAGCGCCGCCCGGCCCCAGTTCAGCATTGATGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl