Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06254

HP ID(1) HP06254
Gene ID(2) 252969
Gene Symbol finder NEIL2
Protein Name nei like 2 (E. coli)
RefSeq NM_145043.1
Length of RefSeq (bp) 2661
Chromosome 8p23.1
Reference DDBJ accession
UniGene Hs.293818

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb55D03 pGCAP1 TGGATCTCCGCCCCCAGCTGGAGCGGCTGTGCGGGCTGCGTAGCGGTGCTGGGTCGGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl